Antibiotic Resistance Genes in MDR/XDR Tuberculosis: Mechanisms, Mutations, and Detection Methods

Table of Contents

• Introduction to Antibiotic Resistance Genes in MDR/XDR Tuberculosis (TB)
• Mutated atpE Gene
• Mechanism of Conferring Resistance of Mutated atpE Gene
• Detection Method of Mutated atpE Gene
• Mutated Rv0678 Gene
• Mechanism of Conferring Resistance of Mutated Rv0678 Gene
• Detection Method of Mutated Rv0678 Gene
• Mutated rpoB Gene
• Mechanism of Conferring Resistance of Mutated rpoB Gene
• Detection Method of Mutated rpoB Gene
• Mutated katG Gene
• Mechanism of Conferring Resistance of Mutated katG Gene
• Detection Method of Mutated katG Gene
• Mutated ethA Gene
• Mechanism of Conferring Resistance of Mutated ethA Gene
• Detection Method of Mutated ethA Gene
• Other Genes Responsible for MDR/XDR-TB
• References

Ready Made Presentation

Introduction to Antibiotic Resistance Genes in MDR/XDR Tuberculosis (TB)

• Antibiotic resistance in multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis arises almost entirely from chromosomal mutations in Mycobacterium tuberculosis, rather than from plasmids or horizontal gene transfer.
• These mutations alter drug targets, activate drug-modifying pathways, or modify cellular processes, ultimately rendering standard antibiotics ineffective.
• Resistance to first-line anti-tuberculosis drugs is primarily associated with mutations in specific genes, including rpoB for rifampicin resistance, katG and the inhA promoter region for isoniazid resistance, embB for ethambutol resistance, pncA for pyrazinamide resistance, and rpsL or rrs for streptomycin resistance (Hudu, 2022; Ntanjane et al., 2025; Hameed et al., 2018; Ghosh et al., 2020).
• Resistance to second-line drugs involves additional genetic loci, including gyrA and gyrB for fluoroquinolone resistance, rrs, eis, and tlyA for resistance to injectable aminoglycosides and capreomycin, and atpE or regulatory genes such as Rv0678 for resistance to newer drugs like bedaquiline (Hudu, 2022; Yao et al., 2021; Chizimu et al., 2023).
• Genome-wide studies demonstrate that antibiotic resistance in tuberculosis is genetically complex and may involve numerous additional genes and intergenic regions, with single-nucleotide polymorphisms (SNPs) and occasional insertions or deletions contributing to diverse resistance profiles across global Mycobacterium tuberculosis lineages (Coll et al., 2018; Zhang et al., 2013; Song et al., 2023; Oppong et al., 2019).
• These resistance-associated mutations often impose a biological fitness cost on the bacterium, which can be partially compensated by secondary or compensatory mutations in genes such as rpoA and rpoC, thereby facilitating the persistence and transmission of resistant strains (Song et al., 2023; Nguyen et al., 2018).
• High-throughput sequencing technologies and targeted molecular diagnostic assays that detect key resistance-associated genes have become essential tools for the rapid diagnosis of MDR/XDR tuberculosis and for guiding individualized treatment strategies.
• However, the continuous identification of novel resistance-associated variants underscores the necessity for ongoing genomic surveillance and the continual refinement of molecular diagnostic methods to effectively monitor and manage drug-resistant tuberculosis (Coll et al., 2018; Zhang et al., 2013; Tang et al., 2024; Li et al., 2022).

Mutated atpE Gene

• The atpE gene encodes subunit c of the F₀F₁ ATP synthase and is present and highly conserved in all members of the Mycobacterium tuberculosis complex, including H37Rv.
• It serves as the primary target of Bedaquiline, which binds within the c-ring of ATP synthase and blocks proton translocation, leading to collapse of ATP synthesis and eventual bacterial death (Guo et al., 2022; Ramirez et al., 2020).
• Specific atpE mutations, including A28V/P, A63P, G61A, and I66M, can result in high-level bedaquiline resistance, with 10–128-fold increases in minimum inhibitory concentration (MIC) observed in vitro.
• Despite their strong resistance effect, these target-site mutations are relatively rare in clinical isolates, likely because they impose a significant fitness cost on the bacterium compared with efflux-based resistance mechanisms (Guo et al., 2022; Umpeleva et al., 2024; Degiacomi et al., 2020; Ramirez et al., 2020).

Mechanism of Conferring Resistance of Mutated atpE Gene

• Missense mutations in the atpE gene alter critical amino acid residues within the c-subunit binding pocket, reducing the binding affinity of bedaquiline while maintaining ATP synthase functionality.
• Mutations such as A63P, G61D/A, and I66M disrupt the interaction between bedaquiline and the c-ring either directly or indirectly and are consistently associated with high MIC values in vitro and in clinical studies, including reports from Russia and other high-burden regions (Guo et al., 2022; Umpeleva et al., 2024; Degiacomi et al., 2020; Zimenkov et al., 2025).
• Not all atpE mutations confer resistance; for instance, the Ile66Val substitution did not increase MIC beyond the critical concentration in engineered H37Rv strains, indicating that some variants represent neutral polymorphisms and require functional validation (Otum et al., 2023).
• In clinical settings, most cases of bedaquiline resistance are attributed to off-target mutations, particularly in Rv0678 (mmpR5), and less frequently in pepQ or Rv1979c, with atpE mutations accounting for a smaller yet clinically significant proportion of high-level resistance (Snobre et al., 2023; Nimmo et al., 2024; Sonnenkalb et al., 2023; Andries et al., 2014; Ramirez et al., 2020).

Detection Method of Mutated atpE Gene

• Targeted PCR followed by Sanger sequencing of the atpE gene remains a reliable method for focused detection of mutations, utilizing primers such as those described in the Singh et al. Indian pilot study.
• However, whole-genome sequencing (WGS) is increasingly preferred as it enables simultaneous detection of mutations in atpE, Rv0678, pepQ, Rv1979c, mmpL5, mmpL4, and other loci associated with bedaquiline resistance and cross-resistance to clofazimine (Guo et al., 2022; Sonnenkalb et al., 2023; Umpeleva et al., 2024; Peng et al., 2024; Degiacomi et al., 2020; Ramirez et al., 2020).
• Recent systematic reviews and meta-analyses indicate that sequencing only atpE and Rv0678 fails to identify a substantial proportion of phenotypically resistant isolates.
• Additionally, many detected genetic variants are of uncertain significance, emphasizing that genotypic results should be interpreted alongside phenotypic MIC testing whenever possible (Otum et al., 2023; Nimmo et al., 2024; Omar et al., 2022).

Key Mutational Hotspots and Clinical Notes

• Common atpE resistance-associated mutations include A28V/P, G61D/A, A63P, and I66M within the c-subunit, all of which are linked to high-level resistance to Bedaquiline (Guo et al., 2022; Umpeleva et al., 2024; Degiacomi et al., 2020; Zimenkov et al., 2025).
• The clinical frequency of atpE resistance-associated variants (RAVs) is generally low compared to Rv0678 mutations in most global cohorts, although higher frequencies have been reported in certain regional studies, particularly from Russia (Snobre et al., 2023; Umpeleva et al., 2024; Zimenkov et al., 2025).
• Other important genes involved in bedaquiline and clofazimine resistance include Rv0678 (associated with the MmpS5–MmpL5 efflux system), pepQ, Rv1979c, and transporter genes such as mmpL5 and mmpL4, which typically contribute to low- to moderate-level resistance and cross-resistance (Snobre et al., 2023; Sonnenkalb et al., 2023; Nimmo et al., 2024; Andries et al., 2014; Ramirez et al., 2020).
• The preferred modern diagnostic approach involves whole-genome sequencing platforms (such as Illumina or Nanopore) combined with phenotypic MIC testing for accurate detection and interpretation of Bedaquiline resistance (Guo et al., 2022; Sonnenkalb et al., 2023; Umpeleva et al., 2024; Peng et al., 2024; Ramirez et al., 2020).

Validated atpE Primer Set for Mycobacterium tuberculosis

Name	Type	Sequence (5′–3′)	Amplicon Size	Notes	Reference
FatpE	Forward Primer	CGGYGCCGGTATCGGYGA	182 bp	Degenerate bases allow broad Mycobacterium detection	Nicolas Radomski et al., 2013
RatpE	Reverse Primer	CGAAGACGAACARSGCCAT	182 bp	Targets conserved region of atpE (Rv1305)	Nicolas Radomski et al., 2013
PatpE	TaqMan Probe	ACSGTGATGAAGAACGGBGTRAA	182 bp	Suitable for real-time PCR (qPCR) detection	Nicolas Radomski et al., 2013

Mutated Rv0678 Gene

• v0678 encodes the MmpR (MmpS5–MmpL5 efflux pump repressor) in Mycobacterium tuberculosis.
• Loss-of-function or destabilizing mutations in Rv0678 derepress the mmpS5–mmpL5 operon, resulting in increased efflux of multiple drugs, particularly Bedaquiline and Clofazimine (Sonnenkalb et al., 2023; Andries et al., 2014).
• These efflux systems are widely distributed among mycobacteria, and Rv0678 variants have been identified across multiple clinical lineages, including isolates collected prior to the introduction of bedaquiline, suggesting a historical reservoir of resistance-associated variants (RAVs) (Nimmo et al., 2024).

Mechanism of Conferring Resistance of Mutated Rv0678 Gene

• Rv0678 functions as a MarR-like transcriptional repressor, and mutations distributed across its DNA-binding and dimerization domains—including missense mutations, frameshifts, IS6110 insertions, and large deletions—reduce DNA binding affinity or protein stability.
• This leads to overexpression of the MmpS5–MmpL5 efflux pump system, which actively exports drugs out of the bacterial cell (Sonnenkalb et al., 2023; Guo et al., 2022; Andries et al., 2014).
• Overexpression of this efflux system typically results in:
• 2–8-fold MIC increases for Bedaquiline in vitro and 2–16-fold in clinical isolates.
• 2–4-fold MIC increases for Clofazimine (Guo et al., 2022; Kaniga et al., 2022; Andries et al., 2014).
• Rv0678 mutations also confer low-level cross-resistance to DprE1 inhibitors such as BTZ043, PBTZ169, OPC-167832, and TBA-7371, typically resulting in 1–2 MIC dilution increases (Almeida et al., 2023; Poulton et al., 2022).
• In clinical datasets, Rv0678 mutations are now the dominant mechanism of resistance to bedaquiline and clofazimine, occurring more frequently than atpE mutations (Omar et al., 2022; Sonnenkalb et al., 2023; Kaniga et al., 2022; Xu et al., 2023).

Detection Method of Mutated Rv0678 Gene

• Due to the high diversity of mutations and absence of defined hotspot codons, full-gene sequencing combined with MIC testing remains the gold standard for detection (Sonnenkalb et al., 2023; Nimmo et al., 2024; Guo et al., 2022).
• Meta-analyses have identified more than 500 candidate resistance mutations across atpE, Rv0678, pepQ, and other genes, many of which are classified as variants of uncertain significance (VUS), limiting the predictive value of genotype-only approaches (Nimmo et al., 2024).
• Many Rv0678 variants are present in bedaquiline-naïve MDR strains and may not elevate MIC above clinical breakpoints, highlighting the need for cautious interpretation of genotypic results (Saeed et al., 2022; Villellas et al., 2016).
• Advanced diagnostic approaches include targeted amplicon sequencing and whole-genome sequencing panels covering Rv0678, mmpL5/mmpS5, pepQ, and Rv1979c to improve detection accuracy (Sonnenkalb et al., 2023; Saeed et al., 2022; Balgouthi et al., 2024).

Primer for Amplification of Rv0678 Gene

• Primers reported by Bhupendra Singh et al. (2020) are suitable for amplifying the Rv0678 gene for Sanger sequencing and targeted amplicon-based approaches.
• Current practices favor designing primers that span the full coding region and promoter of Rv0678 to capture diverse mutations associated with resistance (Otum et al., 2023; Singh et al., 2020).

Name	Type	Sequence (5′–3′)	Amplicon Size	Application	Reference
Rv0678-F	Forward Primer	(Sequence as per study)	~Full gene (~500–600 bp)*	Amplification for sequencing	Bhupendra Singh et al., 2020
Rv0678-R	Reverse Primer	(Sequence as per study)	~Full gene (~500–600 bp)*	Mutation detection	Bhupendra Singh et al., 2020

*Exact amplicon size and sequences should be taken from the original publication or primer design data.

Key Clinical Insight

Aspect	Updated Insight	Citations
Main resistance role	Rv0678 mutations dominate clinical resistance to Bedaquiline and Clofazimine	(Omar et al., 2022; Sonnenkalb et al., 2023; Kaniga et al., 2022; Xu et al., 2023)
Cross-resistance	Resistance extends to BDQ, CFZ, and low-level resistance to DprE1 inhibitors	(Almeida et al., 2023; Poulton et al., 2022; Guo et al., 2022)
Baseline variants	Present even in drug-naïve MDR strains, including pre-antibiotic era isolates	(Saeed et al., 2022; Nimmo et al., 2024; Villellas et al., 2016)
Diagnostics	Requires full-gene sequencing and phenotypic MIC correlation due to VUS prevalence	(Sonnenkalb et al., 2023; Nimmo et al., 2024; Guo et al., 2022)

Key modern findings on Rv0678-mediated resistance to Bedaquiline

Mutated rpoB Gene

• The rpoB gene encodes the β-subunit of DNA-dependent RNA polymerase, which is the primary binding target of rifampicin.
• Most rifampicin resistance in Mycobacterium tuberculosis arises from missense mutations within an 81-bp Rifampicin Resistance-Determining Region (RRDR), spanning codons 507–533 (H37Rv numbering).
• The most frequently mutated codons worldwide are 531, 526, and 516 (corresponding to 450, 445, and 435 in E. coli), and these mutations typically confer high-level resistance.
• Mutations can also occur outside the RRDR, including cluster II and III regions and other sites.
• Some of these non-RRDR mutations act as compensatory mutations, restoring bacterial fitness without significantly altering the minimum inhibitory concentration (MIC).

Mechanism of Conferring Resistance of Mutated rpoB Gene

• Mutations in rpoB produce a structurally altered β-subunit of RNA polymerase.
• This structural alteration reduces or abolishes rifampicin binding while largely preserving transcriptional activity.
• High-level resistance (MIC ≥1–50 µg/mL) is strongly associated with mutations such as S450L/S531L and H445D/Y/R (H526 variants).
• Other substitutions, including D435V (D516V), L430P (L511P), and L533P, often result in low-level or borderline (disputed) resistance.
• These borderline mutations may be missed by standard phenotypic drug susceptibility testing (DST).
• Despite being low-level, these mutations are still associated with poor clinical outcomes when rifampicin-based treatment regimens are used.

Detection Method of Mutated rpoB Gene

• Classical detection methods involve PCR amplification followed by sequencing of the RRDR region.
• Increasingly, full-gene sequencing of rpoB is used to detect rare and compensatory mutations.
• Xpert MTB/RIF and Xpert Ultra
• These are real-time PCR-based assays targeting the RRDR.
• They can detect Mycobacterium tuberculosis and most rifampicin-resistance mutations within approximately 2 hours.
• Probe E (covering codons ~529–533) and Probe B (around codons 511–516) are most frequently affected in many settings.
• Line probe assays (e.g., GenoType MTBDRplus)
• These assays use wild-type and mutation-specific probes across the RRDR.
• Recent studies indicate diagnostic gaps around codons 511, 513, and 516, suggesting the need for additional probe coverage.
• MAS-PCR and other targeted assays
• Multiplex allele-specific PCR targets key codons such as 511, 516, 526, and 531.
• These assays allow rapid screening without sequencing.
• They demonstrate high sensitivity and specificity for detecting multidrug-resistant tuberculosis (MDR-TB).
• Whole-genome sequencing (WGS) and deep sequencing
• These methods detect mixed bacterial populations and heteroresistance.
• They identify non-RRDR mutations and compensatory mutations in rpoA and rpoC.
• They improve understanding of MIC–genotype correlations and regional mutation patterns.

Table: Primer Sequences for Detecting Mutated rpoB (Rifampicin Resistance)

Standard PCR + Sanger Sequencing (RRDR Region)

Use	Primer Name	Type	Sequence (5′→3′)	Product Size	Reference
RRDR (Telenti set)	RP4T	Forward	GAGGCGATCACACCGCAGACGT	255 bp	Alexandre Telenti et al., 1993; S. Patra et al., 2010
	RP8T	Reverse	GATGTTGGGCCCCTCAGGGGTT	255 bp	Alexandre Telenti et al., 1993; S. Patra et al., 2010
Extended rpoB fragment	rpoB F	Forward	GCTGATCCAAAACCAGATCC	440 bp	N. Singpanomchai et al., 2021
	rpoB R	Reverse	ACACGATCTCGTCGCTAACC	440 bp	N. Singpanomchai et al., 2021

MAS-PCR / Allele-Specific PCR (Codons 516, 526, 531)

Use	Primer Name	Type	Sequence (5′→3′)	Target Codon	Reference
Outer primers	ROF	Forward	GTCGCCGCGATCAAGGA	RRDR flank	Igor Mokrousov et al., 2003; P. Sinha et al., 2019
	RIR	Reverse	TGACCCGCGCGTACAC	RRDR flank	Igor Mokrousov et al., 2003
Allele-specific	R516B	Forward	GCTGAGCCAATTCATGGA	Codon 516 (WT)	Igor Mokrousov et al., 2003
	R526B	Forward	GTCGGGGTTGACCCA	Codon 526 (WT)	Igor Mokrousov et al., 2003
	R531B	Forward	ACAAGCGCCGACTGTC	Codon 531 (WT)	Igor Mokrousov et al., 2003

RPA (Isothermal Amplification) / Screening Primers

Use	Primer Name	Type	Sequence (5′→3′)	Product Size	Notes	Reference
RPA/PCR screening	rpoB F	Forward	GCTGATCCAAAACCAGATCC	~440 bp	RRDR amplification	N. Singpanomchai et al., 2021
	rpoB R	Reverse	ACACGATCTCGTCGCTAACC	~440 bp	RRDR amplification	N. Singpanomchai et al., 2021
Allele-specific RPA	—	Forward	29–33 nt primers	Mutation-specific	Includes mismatch design	N. Singpanomchai et al., 2021

Additional Outer Primers for RRDR Amplification

Use	Primer Name	Type	Sequence (5′→3′)	Product Size	Reference
RRDR outer primers	rpoBOF	Forward	GTCGCCGCGATCAAGGA	249 bp	P. Sinha et al., 2019
	rpoBOR	Reverse	TGACCCGCGCGTACAC	249 bp	P. Sinha et al., 2019

Mutated katG Gene and INH Resistance

• The katG gene encodes a catalase–peroxidase enzyme responsible for activation of isoniazid (INH).
• More than 300 katG mutations, including missense, nonsense, frameshift mutations, and deletions, have been associated with INH resistance.
• The S315T mutation remains the most dominant globally and can be present in up to 94% of INH-resistant isolates in certain studies.
• Large whole-genome sequencing datasets confirm that katG mutations account for the majority of INH resistance.
• Additional contributors to INH resistance include mutations in the inhA promoter (fabG1-15C>T), inhA coding region, and other loci such as oxyR–ahpC, ndh, kasA, and furA.
• Biochemically, many katG mutants retain catalase–peroxidase activity but show a marked reduction in INH oxidation and INH–NADH adduct formation.
• This reduction directly impairs activation of the prodrug INH.
• Some mutations drastically reduce both catalase and peroxidase activity, which can attenuate bacterial virulence while still conferring high-level resistance.
• Additional clinically relevant substitutions at codon 315 include S315N, S315I, S315R, S315G, and S315L.
• Other mutations at positions such as N138S, A162E, K414N, R128Q, D311G, and W505* also affect enzyme stability, flexibility, and INH activation.

Mechanism of Conferring Resistance of Mutated katG Gene

• INH resistance correlates most strongly with the loss of INH–NADH adduct formation rather than with total loss of catalase or peroxidase activity.
• Different mutations at the same residue can produce distinct phenotypic outcomes.
• The S315T mutation preserves much of the catalase–peroxidase activity but significantly reduces INH activation.
• The S315N mutation often abolishes both catalase and peroxidase activities and severely impairs bacterial virulence.
• Structural and molecular dynamics studies show that S315 variants alter INH binding.
• These mutations increase local flexibility at the binding pocket and reduce hydrogen-bond interactions.
• This results in impaired activation of the INH prodrug.
• Large phylogenomic analyses indicate that S315T carries a fitness cost, likely due to reduced tolerance to oxidative stress.
• This fitness cost is partially compensated by mutations in ahpC, sodA, and other redox-related pathways.

Detection Method of Mutated katG Gene

• Whole-gene sequencing of katG, often combined with inhA promoter analysis, is recommended to detect both canonical and novel mutations.
• Approximately 10–15% of INH-resistant isolates may lack the common S315T mutation or inhA-15C>T mutation.
• Large genomic analyses incorporating compensatory ahpC mutations have identified at least 31 additional high-confidence katG resistance mutations.
• These mutations can be integrated into modern diagnostic panels to improve detection accuracy.

Molecular Assays and Primer-Based Methods

• LAMP with mismatch primers for S315T.
• This method is probe-free and supports real-time or endpoint detection.
• It demonstrates 100% sensitivity and 96% specificity in a study of 218 isolates.
• It is suitable for rapid INH resistance detection using portable devices such as a hand-held potentiostat.
• Allele-specific RPA combined with SYBR detection.
• Targets mutations in rpoB (codons 516, 526, 531) and katG codon 315.
• Provides isothermal amplification with a visible readout.
• Shows 100% concordance with sequencing results in 141 isolates.
• Suitable for low-resource MDR-TB screening settings.
• Multiplex allele-specific qPCR.
• Targets rpoB codons 516, 526, 531, katG codon 315, and inhA-15.
• Uses contact-quenching probes for detection.
• Capable of detecting low-frequency mutant populations in the presence of excess wild-type DNA.
• Suitable for high-throughput resistance profiling.
• Full katG gene and promoter PCR (KGpromF / KGR).
• Amplifies the katG gene (Rv1908c) along with its upstream regulatory region.
• Used for sequencing and mutagenesis studies.
• Enabled the discovery of 23 novel katG resistance-associated mutations.
• Line-probe assays and MAS-PCR panels primarily target S315T and inhA-15C>T mutations.
• These methods reliably detect INH resistance but do not accurately predict resistance levels (MIC).
• They may fail to detect rare or novel katG mutations.
• Integration of whole-genome sequencing-derived mutation catalogs into diagnostics has improved sensitivity to approximately 98% of resistant isolates.

The following table summarizes commonly used PCR primer pairs for amplification and detection of the katG gene associated with isoniazid resistance in Mycobacterium tuberculosis.

Target / Use	Primer Name	Type	Sequence (5′→3′)	Expected Product	Reference
Full-length / large katG fragment (H37Rv X68081.1 template)	katG-F1	Forward	GAAGTACGGCAAGAAGCTCTC	~724 bp	P. Suryadi et al., 2014
	katG-R1	Reverse	CGTGATCCGCTCATAGATCG	~724 bp	P. Suryadi et al., 2014
Sudan INH-resistant isolates (general katG amplification)	katG-F2	Forward	GCGACGCGTGATCCGCTCATAG	Full/large fragment	Standardized from reported sequence
	katG-R2	Reverse	TCGGCGGTCACACTTT	Full/large fragment	Standardized orientation
MAS-PCR, Northern India (katG fragment incl. codon 315)	katG-F3	Forward	GCAGATGGGGCTGATCTACG	Codon 315 region	A. Gupta et al., 2013
	katG-R3	Reverse	AACGGGTCCGGGATGGTG	Codon 315 region	A. Gupta et al., 2013
Efflux/resistance study, Iran (katG internal fragment)	katG-F4	Forward	CTCGGCGATGAGCGTTAC	Internal fragment	M. Kardan Yamchi et al., 2015
	katG-R4	Reverse	TCCTTGGCGGTGTATTGC	Internal fragment	M. Kardan Yamchi et al., 2015

Mutated ethA Gene

• The ethA (Rv3854c) gene encodes a Baeyer–Villiger monooxygenase (EthA) responsible for activating the prodrug ethionamide (ETH) into an ETH–NAD adduct.
• The ETH–NAD adduct inhibits InhA, leading to blockage of mycolic acid synthesis and ultimately causing cell death.
• EthA is also capable of activating other thioamide drugs, including thiacetazone and isoxyl.
• In clinical isolates, a wide variety of ethA mutations have been identified, including missense, nonsense, frameshift mutations, small insertions/deletions, and 5′UTR/promoter changes.
• Unlike katG S315T mutation, there is no single dominant mutation in ethA associated with ETH resistance.
• Mutations in inhA and its promoter region are more frequently observed than ethA mutations in many ETH-resistant strains.
• These inhA-related mutations significantly contribute to cross-resistance between ethionamide and isoniazid.

Mechanism of Conferring Resistance of Mutated ethA Gene

• Loss-of-function mutations in ethA reduce or completely abolish the activation of ethionamide.
• As a result, the toxic ETH–NAD adduct is not formed, leaving InhA active.
• Continued InhA activity allows uninterrupted mycolic acid synthesis, leading to bacterial survival.
• Structural and in-silico studies of clinical EthA variants such as Y50C, T453I, and V202L demonstrate reduced binding affinity.
• These mutations also destabilize the EthA–FAD–NADP–ETH complex.
• This destabilization explains impaired prodrug activation and increased minimum inhibitory concentrations (MICs).
• Ethionamide resistance is multifactorial and involves additional genetic mechanisms.

Additional mechanisms include:

• Mutations in inhA coding and promoter regions, such as c-15t, S94A, and I194T, which increase InhA expression or reduce ETH–NAD binding, leading to high-level cross-resistance to isoniazid and ethionamide.
• Promoter mutations in ethA, such as −11 t→c, which downregulate ethA transcription and contribute to resistance, particularly when combined with other resistance mutations.
• Mutations in mshA, ndh, Rv0565c, mymA, and other genes that alter ETH activation or disrupt the NADH/NAD⁺ balance, thereby modulating resistance levels.
• Certain Mycobacterium tuberculosis strains remain susceptible to ETH despite ethA loss, indicating that alternative activators such as MymA and Rv0565c can partially compensate.

Detection Method of Mutated ethA Gene

• Due to the scattered and diverse nature of mutations, full-length ethA sequencing, including the coding region and promoter/5′UTR, is considered the reference method for detecting ethA-associated resistance.
• Large-scale studies indicate that combined sequencing of ethA, ethR, and inhA (including promoter regions) explains approximately 70–80% of phenotypic ETH resistance.
• However, 15–30% of resistant isolates do not exhibit known mutations, suggesting the involvement of additional unknown mechanisms.

Primer-Based and Sequencing Strategies

• Full ethA open reading frame (≈1.5 kb) amplification is performed using overlapping PCRs covering the entire gene.
• This approach is used in studies such as Moazemi et al. and in national reference laboratory protocols.
• It enables detection of diverse mutations, including missense, nonsense, frameshift, and insertions/deletions.
• The ethA promoter and ethA–ethR intergenic region are analyzed using PCR followed by Sanger sequencing or next-generation sequencing (NGS).
• This allows identification of regulatory mutations such as −11 t→c and −31G>A.
• Multiplex panels targeting ethA, inhA, ethR, mshA, and other genes are applied using targeted NGS or amplicon sequencing.
• These approaches are commonly used in multidrug-resistant tuberculosis (MDR-TB) cohorts to correlate mutation patterns with MIC values.
• High-throughput whole genome sequencing (WGS) is increasingly utilized for comprehensive mutation detection.
• Curated databases and tools such as WHO catalogues and TB-Profiler are used to classify ethA variants as resistance-associated, benign, or of uncertain significance.
• These tools improve the predictive accuracy of genotypic ethionamide resistance testing.

The following table presents a validated primer pair used for amplification of the ethA gene in Mycobacterium tuberculosis for sequencing and detection of ethionamide resistance–associated mutations.

Target / Use	Primer Type	Sequence (5′ → 3′)	Notes (Amplicon / Use)	Reference
ethA gene fragment (clinical isolates)	Forward	ATC ATC GTC GTC TGA CTA TGG	Used with reverse primer to amplify a portion of the ~1470 bp ethA ORF for sequencing in ETH-resistant and susceptible isolates.	Moazemi et al.
ethA gene fragment (clinical isolates)	Reverse	ACT ACA ACC CCT GGG ACC	Paired with forward primer; part of overlapping PCR strategy to cover the full ethA gene.	Moazemi et al.

Other Genes Responsible for MDR/XDR-TB

The following table summarizes major resistance-associated genes in Mycobacterium tuberculosis, their corresponding antibiotics, and commonly used PCR primers or detection approaches.

Types of Mutated Genes	Resistant Antibiotics	PCR Primers for Detection (5′→3′)	References / Notes	Citations
Mutated rrs gene (16S rRNA)	Aminoglycosides: streptomycin, amikacin, kanamycin, capreomycin, viomycin	F: TTA AAA GCC GGT CTC AGT TC R: TAC GCC CCA CCA GTT GGG GC	Amplifies 3′ region of rrs gene containing key mutations such as A1401G, C1402T, and A514C associated with aminoglycoside resistance.	C. Maus et al., 2005; L. Jugheli et al., 2009; S. Georghiou et al., 2012
Mutated rpsL gene	Primarily streptomycin; often co-occurs in MDR/XDR strains	F: GAA TTC GGT AGA TGC CAA CCA TCC R: TGA AGC TTG ACC AAC GGA CGC TTG GG	Targets S12 protein gene with mutations like K43R and K88R for streptomycin resistance screening.	M. Arjomandzadegan et al., 2015; N. Huy et al., 2023
Mutated inhA (promoter/coding)	Isoniazid and cross-resistance to ethionamide	F: ACA TAC CTG CTG CGC AAT R: TCA CAT TCG ACG CCA AAC	Used to amplify promoter and coding regions of inhA to detect mutations such as c-15t and S94A.	V. Nono et al., 2025
Mutated ahpC (promoter region)	Isoniazid (compensatory mechanism)	—	Typically amplified using custom-designed primers; no universally standardized primer pair available; mainly used as a compensatory marker rather than a primary resistance determinant.	—
Mutated gyrA / gyrB	Fluoroquinolones: ofloxacin, levofloxacin, moxifloxacin	—	Mutations occur in the quinolone resistance-determining region (QRDR); detection commonly performed using line-probe assays or sequencing rather than fixed primer sets.	—
Mutated pncA	Pyrazinamide	F: AAG GCC GCG ATG ACA CCT CT R: GTG TCG TAG AAG CGG CCG AT	Amplifies the relatively short pncA gene for full-length sequencing due to highly diverse mutations.	Jureen et al., 2008
Mutated rpoB (RRDR region)	Rifampicin (key MDR marker)	—	Targets the 81-bp rifampicin resistance-determining region (RRDR); primers vary by protocol and are often included in commercial kits such as GenoType MTBDRplus assay.	—
Mutated embB (codon 306 region)	Ethambutol	—	Focuses on embB306 hotspot region; primers are usually lab-specific or kit-based; full gene sequencing may reveal additional mutations.	Lee et al., 2004
Mutated gidB	Low-level streptomycin resistance; sometimes kanamycin	—	Full ORF amplification followed by sequencing is commonly used to detect diverse missense mutations linked to low-level resistance.	M. Shafipour et al., 2022; H. Jnawali et al., 2013
Mutated tlyA	Capreomycin, viomycin; possible cross-resistance	—	Detection involves amplification and sequencing of the tlyA gene to identify loss-of-function mutations.	C. Maus et al., 2005; H. Jnawali et al., 2013

References

• Almeida, D., Converse, P., & Nuermberger, E. (2023). Mutations in Rv0678 reduce susceptibility of Mycobacterium tuberculosis to the DprE1 inhibitor TBA-7371. Antimicrobial Agents and Chemotherapy, 67. https://doi.org/10.1128/aac.00052-23
• Almeida, D., Ioerger, T., Tyagi, S., Li, S., Mdluli, K., Andries, K., Grosset, J., Sacchettini, J., & Nuermberger, E. (2016). Mutations in pepQ confer low-level resistance to bedaquiline and clofazimine in Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy, 60, 4590–4599. https://doi.org/10.1128/aac.00753-16
• Balgouthi, K., AlMatar, M., Saghrouchni, H., Albarri, O., & Var, I. (2024). Mutations in Rv0678, Rv2535c, and Rv1979c confer resistance to bedaquiline in clinical isolates of Mycobacterium tuberculosis. Current Molecular Pharmacology. https://doi.org/10.2174/0118761429314641240815080447
• Chizimu, J., Solo, E., Bwalya, P., Kapalamula, T., Mwale, K., Squarre, D., … Suzuki, Y. (2023). Genomic analysis of Mycobacterium tuberculosis strains resistant to second-line anti-tuberculosis drugs in Lusaka, Zambia. Antibiotics, 12. https://doi.org/10.3390/antibiotics12071126
• Coll, F., Phelan, J., Hill-Cawthorne, G., Nair, M., Mallard, K., Ali, S., … Clark, T. (2018). Genome-wide analysis of multi- and extensively drug-resistant Mycobacterium tuberculosis. Nature Genetics, 50, 307–316. https://doi.org/10.1038/s41588-017-0029-0
• Degiacomi, G., Sammartino, J., Sinigiani, V., Marra, P., Urbani, A., & Pasca, M. (2020). In vitro study of bedaquiline resistance in Mycobacterium tuberculosis multi-drug resistant clinical isolates. Frontiers in Microbiology, 11. https://doi.org/10.3389/fmicb.2020.559469
• Ghosh, A., N., S., & Saha, S. (2020). Survey of drug resistance associated gene mutations in Mycobacterium tuberculosis, ESKAPE and other bacterial species. Scientific Reports, 10. https://doi.org/10.1038/s41598-020-65766-8
• Guo, Q., Bi, J., Lin, Q., Ye, T., Wang, Z., Wang, Z., Liu, L., & Zhang, G. (2022). Whole genome sequencing identifies novel mutations associated with bedaquiline resistance in Mycobacterium tuberculosis. Frontiers in Cellular and Infection Microbiology, 12. https://doi.org/10.3389/fcimb.2022.807095
• Hameed, H., Hameed, H., Islam, M., Islam, M., Chhotaray, C., Chhotaray, C., … Zhang, T. (2018). Molecular targets related drug resistance mechanisms in MDR-, XDR-, and TDR-Mycobacterium tuberculosis strains. Frontiers in Cellular and Infection Microbiology, 8. https://doi.org/10.3389/fcimb.2018.00114
• Hudu, S. (2022). An overview of the pattern of first- and second-line anti-tuberculosis drug resistance gene mutations. International Journal of Frontline Research in Multidisciplinary Studies. https://doi.org/10.56355/ijfrms.2022.1.1.0031
• Kaniga, K., Lounis, N., Zhuo, S., Bakare, N., & Andries, K. (2022). Impact of Rv0678 mutations on patients with drug-resistant TB treated with bedaquiline. The International Journal of Tuberculosis and Lung Disease, 26, 571–573. https://doi.org/10.5588/ijtld.21.0670
• Li, S., Poulton, N., Chang, J., Azadian, Z., DeJesus, M., Ruecker, N., … Rock, J. (2022). CRISPRi chemical genetics and comparative genomics identify genes mediating drug potency in Mycobacterium tuberculosis. Nature Microbiology, 7, 766–779. https://doi.org/10.1038/s41564-022-01130-y
• Nimmo, C., Bionghi, N., Cummings, M., Perumal, R., Hopson, M., Jubaer, A., … O’Donnell, M. (2024). Opportunities and limitations of genomics for diagnosing bedaquiline-resistant tuberculosis: a systematic review and individual isolate meta-analysis. The Lancet Microbe, 5, e164–e172. https://doi.org/10.1016/s2666-5247(23)00317-8
• Nimmo, C., Ortiz, A., Tan, C., Pang, J., Acman, M., Millard, J., … Van Dorp, L. (2024). Detection of a historic reservoir of bedaquiline/clofazimine resistance-associated variants in Mycobacterium tuberculosis. Genome Medicine, 16. https://doi.org/10.1186/s13073-024-01289-5
• Ntanjane, M., Kgokong, B., & Makhoahle, P. (2025). Literature review on multi-extensively drug-resistant Mycobacterium tuberculosis mutations: Highlighting molecular analysis gaps at Tshepong NHLS referral laboratory. African Journal of Biomedical Research. https://doi.org/10.53555/ajbr.v28i3s.7812
• Omar, S., Ismail, F., Ndjeka, N., Kaniga, K., & Ismail, N. (2022). Bedaquiline-resistant tuberculosis associated with Rv0678 mutations. The New England Journal of Medicine, 386(1), 93–94. https://doi.org/10.1056/nejmc2103049
• Oppong, Y., Phelan, J., Perdigão, J., Machado, D., Miranda, A., Portugal, I., … Hibberd, M. (2019). Genome-wide analysis of Mycobacterium tuberculosis polymorphisms reveals lineage-specific associations with drug resistance. BMC Genomics, 20. https://doi.org/10.1186/s12864-019-5615-3
• Peng, Y., Li, C., Hui, X., Huo, X., Shumuyed, N., & Jia, Z. (2024). Phenotypic and genotypic analysis of drug resistance in M. tuberculosis isolates in Gansu, China. PLOS ONE, 19. https://doi.org/10.1371/journal.pone.0311042
• Poulton, N., Azadian, Z., DeJesus, M., & Rock, J. (2022). Mutations in rv0678 confer low-level resistance to benzothiazinone DprE1 inhibitors in Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy, 66. https://doi.org/10.1128/aac.00904-22
• Radomski, N., Kreitmann, L., McIntosh, F., & Behr, M. A. (2013). The critical role of DNA extraction for detection of mycobacteria in tissues. PLoS ONE, 8(10), e78749. https://doi.org/10.1371/journal.pone.0078749
• Saeed, D., Shakoor, S., Razzak, S., Hasan, Z., Sabzwari, S., Azizullah, Z., … Hasan, R. (2022). Variants associated with bedaquiline (BDQ) resistance identified in Rv0678 and efflux pump genes in Mycobacterium tuberculosis isolates from BDQ naïve TB patients in Pakistan. BMC Microbiology, 22. https://doi.org/10.1186/s12866-022-02475-4
• Singh, B., Soneja, M., Sharma, R., Chaubey, J., Kodan, P., Jorwal, P., … Wig, N. (2020). Mutation in atpE and Rv0678 genes associated with bedaquiline resistance among drug-resistant tuberculosis patients: A pilot study from a high-burden setting in Northern India. International Journal of Mycobacteriology, 9, 212–215. https://doi.org/10.4103/ijmy.ijmy_30_20
• Song, Z., Liu, C., He, W., Pei, S., Liu, D., Cao, X., … Zhao, Y. (2023). Insight into the drug-resistant characteristics and genetic diversity of multidrug-resistant Mycobacterium tuberculosis in China. Microbiology Spectrum, 11. https://doi.org/10.1128/spectrum.01324-23
• Tang, C., Wu, L., Li, M., Dai, J., Shi, Y., Wang, Q., … Xiang, G. (2024). High-throughput nanopore targeted sequencing for efficient drug resistance assay of Mycobacterium tuberculosis. Frontiers in Microbiology, 15. https://doi.org/10.3389/fmicb.2024.1331656
• Villellas, C., Coeck, N., Meehan, C., Lounis, N., De Jong, B., Rigouts, L., & Andries, K. (2016). Unexpected high prevalence of resistance-associated Rv0678 variants in MDR-TB patients without documented prior use of clofazimine or bedaquiline. Journal of Antimicrobial Chemotherapy, 72, 684–690. https://doi.org/10.1093/jac/dkw502
• Xu, J., Li, D., Shi, J., Wang, B., Ge, F., Guo, Z., … Lu, Y. (2023). Bedaquiline resistance mutations: Correlations with drug exposures and impact on the proteome in M. tuberculosis. Antimicrobial Agents and Chemotherapy, 67. https://doi.org/10.1128/aac.01532-22
• Yao, C., Guo, H., Li, Q., Zhang, X., Shang, Y., Li, T., … Pang, Y. (2021). Prevalence of extensively drug-resistant tuberculosis in a Chinese multidrug-resistant TB cohort after redefinition. Antimicrobial Resistance and Infection Control, 10. https://doi.org/10.1186/s13756-021-00995-8
• Zhang, H., Li, D., Zhao, L., Fleming, J., Lin, N., Wang, T., … Bi, L. (2013). Genome sequencing of 161 Mycobacterium tuberculosis isolates from China identifies genes and intergenic regions associated with drug resistance. Nature Genetics, 45, 1255–1260. https://doi.org/10.1038/ng.2735
• Zimenkov, D., Ushtanit, A., Gordeeva, E., Guselnikova, E., Schwartz, Y., & Stavitskaya, N. (2025). High prevalence of atpE mutations in bedaquiline-resistant Mycobacterium tuberculosis isolates, Russia. Emerging Infectious Diseases, 31, 526–535. https://doi.org/10.3201/eid3103.241488